pCDH-EF1-copGFP-T2A-Puro vector (Cat. No.: V001322)

Copy Sequence View Map

Basic Information

Note: It is a 3rd gen lenti-vector. The 3rd generation LV packaging plasmid includes gag, coding for the virion main structural proteins; pol, responsible for the retrovirus-specific enzymes; and RRE, a binding site for the Rev protein which facilitates export of the RNA from the nucleus. This plasmid does not include Rev. The third-generation packaging system offers maximal biosafety but is more cumbersome, as it involves the transfection of four different plasmids in the producer cells.

If you wish to use the 3rd gen lentivector, you need to have a lentiviral vector with a chimeric 5' LTR in which the HIV promoter is replaced with CMV or RSV, thus making it TAT-independent. Examples of these vectors include pLKO.1, pLL3.7, pLB, pLenti6, pSico, pCL and pCS. Most Aebischer and Trono lab lentiviral vectors CANNOT be used with this system. A lentiviral vector carrying a chimeric 5' LTR can be packaged with either the 2nd or 3rd generation packaging system.

Name:: pCDH-EF1-copGFP-T2A-Puro

Antibiotic Resistance:: Ampicillin

Length:: 8595 bp

Type:: Mammalian Expression, Lentiviral

Replication origin:: ori

Selection Marker:: Puromycin

Copy Number:: High Copy

Promoter:: EF-1α

Cloning Method:: Restriction Enzyme

5' Primer:: GCACTTGATGTAATTCTCC

3' Primer:: CAACACCACGGAATTGTCAG

$ 198.4

In stock, instant shipping

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Resources

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

Maughan EF, Hynds RE, Pennycuick A, Nigro E, Gowers KHC, Denais C, Gómez-López S, Lazarus KA, Orr JC, Pearce DR, Clarke SE, Lee DDH, Woodall MNJ, Masonou T, Case KM, Teixeira VH, Hartley BE, Hewitt RJ, Al Yaghchi C, Sandhu GS, Birchall MA, O'Callaghan C, Smith CM, De Coppi P, Butler CR, Janes SM. Cell-intrinsic differences between human airway epithelial cells from children and adults. iScience. 2022 Oct 20;25(11):105409.