Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V001372 | Flag-HA-CYLD | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- Flag-HA-CYLD
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9307 bp
- Type:
- Mammalian Expression, Retroviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- MSCV
- Cloning Method:
- Gateway Cloning
- 5' Primer:
- CAGCCCTCACTCCTTCTCTAGG
- 3' Primer:
- CAAGCGGCTTCGGCCAGTAAC
Flag-HA-CYLD vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
Flag-HA-CYLD vector Sequence
LOCUS V001372 9307 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V001372
VERSION V001372
KEYWORDS Flag-HA-CYLD
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9307)
AUTHORS Sowa ME, Bennett EJ, Gygi SP, Harper JW
TITLE Defining the human deubiquitinating enzyme interaction landscape.
JOURNAL Cell. 2009 Jul 23. 138(2):389-403.
PUBMED 19615732
REFERENCE 2 (bases 1 to 9307)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9307)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2009
Jul 23. 138(2):389-403."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9307
/mol_type="other DNA"
/organism="synthetic DNA construct"
protein_bind 107..128
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 143..173
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 181..197
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
LTR complement(359..873)
/label="3' LTR"
/note="3' long terminal repeat from murine embryonic stem
cell virus"
CDS complement(952..1548)
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature complement(1549..2125)
/label="IRES2"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
protein_bind 2142..2166
/label="attB2"
/note="recombination site for the Gateway(R) BP reaction"
CDS complement(2179..5037)
/gene="CYLD"
/label="Ubiquitin carboxyl-terminal hydrolase CYLD"
/note="Ubiquitin carboxyl-terminal hydrolase CYLD from Bos
taurus. Accession#: Q1RMU2"
protein_bind complement(5046..5070)
/gene="mutant version of attB"
/label="attB1"
/bound_moiety="BP Clonase(TM)"
/note="recombination site for the Gateway(R) BP reaction"
CDS complement(5086..5112)
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
CDS complement(5125..5148)
/label="FLAG"
/note="FLAG(R) epitope tag, followed by an enterokinase
cleavage site"
regulatory 5148..5157
/label="Kozak sequence"
/note="vertebrate consensus sequence for strong initiation
of translation (Kozak, 1987)"
/regulatory_class="other"
CDS complement(5170..5586)
/label="gag (truncated)"
/note="truncated Moloney murine leukemia virus (MMLV) gag
gene lacking the start codon"
misc_feature complement(5653..5994)
/label="MESV Psi"
/note="packaging signal of murine embryonic stem cell
virus"
LTR complement(6058..6574)
/label="5' LTR"
/note="5' long terminal repeat from murine embryonic stem
cell virus"
primer_bind complement(6774..6793)
/label="pBRrevBam"
/note="pBR322 vectors, tet region, downstream of BamHI,
reverse primer"
primer_bind complement(6921..6943)
/label="M13/pUC Forward"
/note="In lacZ gene"
primer_bind complement(7137..7156)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 7256..7278
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind complement(7316..7334)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 7402..7506
/label="AmpR promoter"
CDS 7507..8364
/label="AmpR"
/note="beta-lactamase"
rep_origin 8538..9126
/direction=RIGHT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 9280..9297
/label="L4440"
/note="L4440 vector, forward primer"