Flag-HA-CYLD vector (V001372)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V001372 Flag-HA-CYLD In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
Flag-HA-CYLD
Antibiotic Resistance:
Ampicillin
Length:
9307 bp
Type:
Mammalian Expression, Retroviral
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
MSCV
Cloning Method:
Gateway Cloning
5' Primer:
CAGCCCTCACTCCTTCTCTAGG
3' Primer:
CAAGCGGCTTCGGCCAGTAAC

Flag-HA-CYLD vector Map

Flag-HA-CYLD9307 bp400800120016002000240028003200360040004400480052005600600064006800720076008000840088009200CAP binding sitelac promoterlac operator3' LTRPuroRIRES2attB2Ubiquitin carboxyl-terminal hydrolase CYLDattB1HAFLAGgag (truncated)MESV Psi5' LTRpBRrevBamIn lacZ genepRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRoriL4440

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

Flag-HA-CYLD vector Sequence

LOCUS       V001372                 9307 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001372
VERSION     V001372
KEYWORDS    Flag-HA-CYLD
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9307)
  AUTHORS   Sowa ME, Bennett EJ, Gygi SP, Harper JW
  TITLE     Defining the human deubiquitinating enzyme interaction landscape.
  JOURNAL   Cell. 2009 Jul 23. 138(2):389-403.
   PUBMED   19615732
REFERENCE   2  (bases 1 to 9307)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9307)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2009
            Jul 23. 138(2):389-403."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9307
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     protein_bind    107..128
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        143..173
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    181..197
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     LTR             complement(359..873)
                     /label="3' LTR"
                     /note="3' long terminal repeat from murine embryonic stem
                     cell virus"
     CDS             complement(952..1548)
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    complement(1549..2125)
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     protein_bind    2142..2166
                     /label="attB2"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             complement(2179..5037)
                     /gene="CYLD"
                     /label="Ubiquitin carboxyl-terminal hydrolase CYLD"
                     /note="Ubiquitin carboxyl-terminal hydrolase CYLD from Bos
                     taurus. Accession#: Q1RMU2"
     protein_bind    complement(5046..5070)
                     /gene="mutant version of attB"
                     /label="attB1"
                     /bound_moiety="BP Clonase(TM)"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             complement(5086..5112)
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     CDS             complement(5125..5148)
                     /label="FLAG"
                     /note="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     regulatory      5148..5157
                     /label="Kozak sequence"
                     /note="vertebrate consensus sequence for strong initiation
                     of translation (Kozak, 1987)"
                     /regulatory_class="other"
     CDS             complement(5170..5586)
                     /label="gag (truncated)"
                     /note="truncated Moloney murine leukemia virus (MMLV) gag
                     gene lacking the start codon"
     misc_feature    complement(5653..5994)
                     /label="MESV Psi"
                     /note="packaging signal of murine embryonic stem cell
                     virus"
     LTR             complement(6058..6574)
                     /label="5' LTR"
                     /note="5' long terminal repeat from murine embryonic stem
                     cell virus"
     primer_bind     complement(6774..6793)
                     /label="pBRrevBam"
                     /note="pBR322 vectors, tet region, downstream of BamHI,
                     reverse primer"
     primer_bind     complement(6921..6943)
                     /label="M13/pUC Forward"
                     /note="In lacZ gene"
     primer_bind     complement(7137..7156)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     primer_bind     7256..7278
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(7316..7334)
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"
     promoter        7402..7506
                     /label="AmpR promoter"
     CDS             7507..8364
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      8538..9126
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     9280..9297
                     /label="L4440"
                     /note="L4440 vector, forward primer"