Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V001401 | pDule-pCNF | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pDule-pCNF
- Antibiotic Resistance:
- Tetracycline
- Length:
- 6333 bp
- Type:
- Bacterial Expression
- Replication origin:
- p15A ori
- Copy Number:
- Low Copy
- Promoter:
- tet
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- CGTCACTGCGTCTTTTACTG
pDule-pCNF vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pDule-pCNF vector Sequence
LOCUS V001401 6333 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V001401
VERSION V001401
KEYWORDS pDule-pCNF
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 6333)
AUTHORS Miyake-Stoner SJ, Miller AM, Hammill JT, Peeler JC, Hess KR, Mehl
RA, Brewer SH
TITLE Probing protein folding using site-specifically encoded unnatural
amino acids as FRET donors with tryptophan.
JOURNAL Biochemistry. 2009 Jun 30;48(25):5953-62. doi: 10.1021/bi900426d.
PUBMED 19492814
REFERENCE 2 (bases 1 to 6333)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 6333)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10"; journalName:
"Biochemistry"; date: "2009-06-30- 30"; volume: "48"; issue: "25";
pages: "5953-62"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..6333
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 194..1111
/gene="tyrS"
/label="Tyrosine--tRNA ligase"
/note="Tyrosine--tRNA ligase from Methanocaldococcus
jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM
10045 / NBRC 100440). Accession#: Q57834"
CDS 1161..1190
/label="Myc"
/note="Myc (human c-Myc proto-oncogene) epitope tag"
CDS 1206..1223
/label="6xHis"
/note="6xHis affinity tag"
primer_bind complement(1279..1296)
/label="pBAD Reverse"
/note="For vectors with E. coli araBAD promoter, reverse
primer"
terminator 1449..1535
/label="rrnB T1 terminator"
/note="transcription terminator T1 from the E. coli rrnB
gene"
primer_bind complement(1742..1759)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(1876..2421)
/direction=LEFT
/label="p15A ori"
/note="Plasmids containing the medium-copy-number p15A
origin of replication can be propagated in E. coli cells
that contain a second plasmid with the ColE1 origin."
promoter 2533..2561
/label="tet promoter"
/note="E. coli promoter for tetracycline efflux protein
gene"
CDS 2609..3796
/label="TcR"
/note="tetracycline efflux protein"
primer_bind 4121..4137
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind 5121..5143
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
CDS complement(5302..6177)
/label="araC"
/note="L-arabinose regulatory protein"