lenti sgRNA(MS2)_puro backbone vector (V001436)

Basic Vector Information

      • Vector Name:
      • lenti sgRNA(MS2)_puro backbone
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 10222 bp
      • Type:
      • Mammalian Expression, Lentiviral, CRISPR
      • Selection Marker:
      • Puromycin
      • Copy Number:
      • High Copy
      • Promoter:
      • U6 and EF1A
      • Cloning Method:
      • Restriction Enzyme
      • 5' Primer:
      • 3' Primer:
      • cctagaaggtccattagctgcaaagattcc

lenti sgRNA(MS2)_puro backbone vector Vector Map

lenti sgRNA(MS2)_puro backbone10222 bp50010001500200025003000350040004500500055006000650070007500800085009000950010000pBABE 3'EM7 promoterBleoRSV40 poly(A) signalM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-markerCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptidecPPT/CTSU6 promoterMS2 stem loopMS2 stem loopEF-1-alpha promoterPuroRWPREKS primer5' LTR (truncated)BGH-revf1 ori

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

lenti sgRNA(MS2)_puro backbone vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported               10222 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  3rd generation lenti sgRNA cloning backbone with MS2 loops at 
            tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains 
            BsmBI sites for insertion of spacer sequences..
KEYWORDS    lenti sgRNA(MS2)_puro backbone
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 10222)
  AUTHORS   Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena 
            C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F
  TITLE     Genome-scale transcriptional activation by an engineered CRISPR-Cas9
  JOURNAL   Nature. 2014 Dec 10. doi: 10.1038/nature14136.
  PUBMED    25494202
REFERENCE   2  (bases 1 to 10222)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nature. 
            2014 Dec 10. doi: 10.1038/nature14136."
FEATURES             Location/Qualifiers
     source          1..10222
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     primer_bind     complement(81..101)
                     /label=pBABE 3'
                     /note="SV40 enhancer, reverse primer for pBABE vectors"
     promoter        86..415
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     rep_origin      266..401
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     primer_bind     328..347
                     /note="SV40 promoter/origin, forward primer"
     promoter        463..510
                     /label=EM7 promoter
                     /note="synthetic bacterial promoter "
     CDS             529..903
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     polyA_signal    1033..1154
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(1070..1089)
                     /note="SV40 polyA, reverse primer"
     primer_bind     1124..1143
                     /note="SV40 polyA terminator, reverse primer"
     primer_bind     complement(1203..1219)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(1203..1219)
                     /label=M13 Reverse
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(1216..1238)
                     /label=M13/pUC Reverse
                     /note="In lacZ gene"
     protein_bind    1227..1243
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1251..1281)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    1296..1317
                     /label=CAP binding site
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     primer_bind     complement(1434..1451)
                     /note="L4440 vector, forward primer"
     rep_origin      complement(1605..2193)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     complement(1685..1704)
                     /note="pBR322 origin, forward primer"
     CDS             complement(2364..3224)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     2987..3006
                     /note="Ampicillin resistance gene, reverse primer"
     promoter        complement(3225..3329)
                     /label=AmpR promoter
     primer_bind     complement(3404..3423)
                     /note="pRS vectors, use to sequence yeast selectable 
     enhancer        3595..3974
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        3976..4174
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early 
     primer_bind     4129..4149
                     /note="Human CMV immediate early promoter, forward primer"
     LTR             4192..4372
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    4419..4544
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus 
                     type 1"
     misc_feature    5037..5270
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
     CDS             5455..5499
                     /product="antigenic peptide corresponding to amino acids 
                     655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik 
                     et al., 2013)"
                     /label=gp41 peptide
                     /note="recognized by the 2H10 single-chain llama nanobody"
     misc_feature    5797..5914
                     /note="central polypurine tract and central termination 
                     sequence of HIV-1"
     promoter        5964..6204
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     primer_bind     5964..5984
                     /note="Human U6 promoter, forward primer"
     primer_bind     6135..6154
                     /label=LKO.1 5'
                     /note="Human U6 promoter, forward primer"
     misc_RNA        6250..6268
                     /label=MS2 stem loop
                     /note="stem loop that binds the bacteriophage MS2 coat 
     misc_RNA        6320..6338
                     /label=MS2 stem loop
                     /note="stem loop that binds the bacteriophage MS2 coat 
     promoter        6462..7640
                     /label=EF-1-alpha promoter
                     /note="strong constitutive promoter for human elongation 
                     factor EF-1-alpha"
     intron          6693..7631
                     /label=EF-1-alpha intron A
                     /note="intron upstream of the start codon of human 
     primer_bind     7588..7608
                     /note="Human elongation factor-1a promoter, forward primer"
     CDS             7647..8246
                     /gene="pac from Streptomyces alboniger"
                     /product="puromycin N-acetyltransferase"
                     /note="confers resistance to puromycin"
     primer_bind     complement(7647..7666)
                     /note="Puromycin resistance gene, reverse primer. Also 
                     called puro-variant-R"
     primer_bind     8143..8163
                     /note="Puromycin resistance gene, forward primer"
     misc_feature    8271..8859
                     /note="woodchuck hepatitis virus posttranscriptional 
                     regulatory element"
     primer_bind     complement(8324..8344)
                     /note="WPRE, reverse primer"
     CDS             complement(8742..8753)
                     /product="Factor Xa recognition and cleavage site"
                     /label=Factor Xa site
     primer_bind     complement(8862..8878)
                     /label=KS primer
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(8863..8879)
                     /note="For pBluescript vector"
     LTR             9384..9564
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     primer_bind     complement(9590..9607)
                     /note="Bovine growth hormone terminator, reverse primer. 
                     Also called BGH reverse"
     polyA_signal    9596..9820
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      join(9866..10222,1..72)
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(9953..9972)
                     /note="F1 origin, reverse primer"
     primer_bind     10163..10184
                     /note="F1 origin, forward primer"

This page is informational only.