Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V001436 | lenti sgRNA(MS2)_puro backbone | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- lenti sgRNA(MS2)_puro backbone
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10222 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
- 3' Primer:
- cctagaaggtccattagctgcaaagattcc
lenti sgRNA(MS2)_puro backbone vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
lenti sgRNA(MS2)_puro backbone vector Sequence
LOCUS V001436 10222 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V001436 VERSION V001436 KEYWORDS lenti sgRNA(MS2)_puro backbone SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 10222) AUTHORS Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F TITLE Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. JOURNAL Nature. 2014 Dec 10. doi: 10.1038/nature14136. PUBMED 25494202 REFERENCE 2 (bases 1 to 10222) TITLE Direct Submission REFERENCE 3 (bases 1 to 10222) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nature. 2014 Dec 10. doi: 10.1038/nature14136." SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..10222 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 86..415 /label="SV40 promoter" /note="SV40 enhancer and early promoter" promoter 463..510 /label="EM7 promoter" /note="synthetic bacterial promoter" CDS 529..900 /label="BleoR" /note="antibiotic-binding protein" polyA_signal 1033..1166 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" primer_bind complement(1203..1219) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" primer_bind complement(1203..1219) /label="M13 Reverse" /note="In lacZ gene. Also called M13-rev" primer_bind complement(1216..1238) /label="M13/pUC Reverse" /note="In lacZ gene" protein_bind 1227..1243 /label="lac operator" /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(1251..1281) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(1296..1317) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." primer_bind complement(1434..1451) /label="L4440" /note="L4440 vector, forward primer" rep_origin complement(1605..2193) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(2367..3224) /label="AmpR" /note="beta-lactamase" promoter complement(3225..3329) /label="AmpR promoter" primer_bind complement(3404..3423) /label="pRS-marker" /note="pRS vectors, use to sequence yeast selectable marker" enhancer 3595..3974 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 3975..4177 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" LTR 4192..4372 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 4419..4544 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 5037..5270 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 5455..5499 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 5648..5689 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 5797..5914 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 5964..6204 /label="U6 promoter" /note="RNA polymerase III promoter for human U6 snRNA" misc_RNA 6250..6268 /label="MS2 stem loop" /note="stem loop that binds the bacteriophage MS2 coat protein" misc_RNA 6320..6338 /label="MS2 stem loop" /note="stem loop that binds the bacteriophage MS2 coat protein" promoter 6462..7640 /label="EF-1-alpha promoter" /note="strong constitutive promoter for human elongation factor EF-1-alpha" CDS 7647..8243 /label="PuroR" /note="puromycin N-acetyltransferase" misc_feature 8271..8859 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" primer_bind complement(8862..8878) /label="KS primer" /note="common sequencing primer, one of multiple similar variants" primer_bind complement(8863..8879) /label="pBluescriptKS" /note="For pBluescript vector" LTR 9384..9564 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" polyA_signal 9596..9820 /label="bGH poly(A) signal" /note="bovine growth hormone polyadenylation signal" primer_bind complement(9953..9972) /label="F1ori-R" /note="F1 origin, reverse primer" primer_bind 10163..10184 /label="F1ori-F" /note="F1 origin, forward primer"