Cart 2

EJ2GFP-puro vector (V001709#)

Basic Vector Information

Basic Vector Information
Vector Name EJ2GFP-puro Antibiotic Resistance Ampicillin
Length 7642 bp Type Mammalian Expression
Selection Marker Puromycin Promoter pCAGGS
5' Primer ttcctacagctcctgggcaacg 3' Primer ttttggcagagggaaaaaga

EJ2GFP-puro vector Vector Map

EJ2GFP-puro7642 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600690072007500CMV enhancerchimeric intronpCAG-FSV40 NLSSV40 NLSKozak sequenceBglob-pA-Rbeta-globin poly(A) signalSP6 promoterpRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRoriL4440T7PGK promoterPuroR

Plasmid Resuspension protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

EJ2GFP-puro vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                7642 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7642)
  AUTHORS   Bennardo N, Cheng A, Huang N, Stark JM
  TITLE     Alternative-NHEJ is a mechanistically distinct pathway of mammalian 
            chromosome break repair.
  JOURNAL   PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 
  PUBMED    18584027
REFERENCE   2  (bases 1 to 7642)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "PLoS 
            Genet."; date: "2008-06-27"; volume: "4(6):e1000110. doi"; pages: " 
FEATURES             Location/Qualifiers
     source          1..7642
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        1..380
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     intron          658..1674
                     /label=chimeric intron
                     /note="chimera between introns from chicken beta-actin and 
                     rabbit beta-globin"
     primer_bind     1598..1620
                     /note="Chimeric intron in CAG promoter, forward primer"
     primer_bind     1682..1701
                     /note="Rabbit beta-globin intron, for pCAG plasmids, 
                     forward primer"
     CDS             1763..1783
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             1805..1825
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     regulatory      2074..2083
                     /label=Kozak sequence
                     /note="vertebrate consensus sequence for strong initiation 
                     of translation (Kozak, 1987)"
     CDS             2080..2799
                     /product="the original enhanced GFP (Yang et al., 1996)"
                     /note="mammalian codon-optimized"
     CDS             2080..2796
                     /product="enhanced GFP"
     primer_bind     complement(2125..2146)
                     /note="EGFP, reverse primer"
     primer_bind     complement(2386..2405)
                     /note="For distinguishing EGFP variants, reverse primer"
     primer_bind     2733..2754
                     /note="EGFP, forward primer"
     primer_bind     complement(3004..3023)
                     /note="Rabbit beta-globin polyA region, reverse primer"
     polyA_signal    3069..3124
                     /label=beta-globin poly(A) signal
                     /note="rabbit beta-globin polyadenylation signal (Gil and 
                     Proudfoot, 1987)"
     primer_bind     complement(3123..3142)
                     /note="Rabbit beta-globin polyA, reverse primer. Also 
                     called rb-glob-pA-term-R"
     promoter        complement(3482..3500)
                     /label=SP6 promoter
                     /note="promoter for bacteriophage SP6 RNA polymerase"
     primer_bind     complement(3483..3500)
                     /note="SP6 promoter, forward primer"
     primer_bind     complement(3581..3600)
                     /note="pRS vectors, use to sequence yeast selectable 
     primer_bind     3700..3722
                     /label=pGEX 3'
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(3760..3778)
                     /note="pBR322 vectors, upsteam of EcoRI site, forward 
     promoter        3846..3950
                     /label=AmpR promoter
     CDS             3951..4811
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     complement(4169..4188)
                     /note="Ampicillin resistance gene, reverse primer"
     rep_origin      4982..5570
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     5471..5490
                     /note="pBR322 origin, forward primer"
     primer_bind     5724..5741
                     /note="L4440 vector, forward primer"
     primer_bind     5828..5847
                     /note="T7 promoter, forward primer"
     promoter        5828..5846
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        5884..6381
                     /label=PGK promoter
                     /note="mouse phosphoglycerate kinase 1 promoter"
     primer_bind     complement(5919..5942)
                     /note="Murine stem cell virus, reverse primer"
     primer_bind     6314..6333
                     /note="Mouse PGK promoter, forward primer"
     CDS             6400..6999
                     /gene="pac from Streptomyces alboniger"
                     /product="puromycin N-acetyltransferase"
                     /note="confers resistance to puromycin"
     primer_bind     complement(6400..6419)
                     /note="Puromycin resistance gene, reverse primer. Also 
                     called puro-variant-R"
     primer_bind     6896..6916
                     /note="Puromycin resistance gene, forward primer"

This page is informational only.