pCCLc-MND-A0201-SABR-Backbone vector (V001004)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V001004 pCCLc-MND-A0201-SABR-Backbone In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pCCLc-MND-A0201-SABR-Backbone
Antibiotic Resistance:
Ampicillin
Length:
10927 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Selection Marker:
surface myc-tag
Copy Number:
High Copy
Promoter:
T3
5' Primer:
GCTCCCCGAGCTCAATAAAAG
3' Primer:
TGGCTAAGATCTACAGCTGCCTT

pCCLc-MND-A0201-SABR-Backbone vector Map

pCCLc-MND-A0201-SABR-Backbone10927 bp5001000150020002500300035004000450050005500600065007000750080008500900095001000010500CAP binding sitelac promoterIn lacZ geneT3 promoterCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSMNDU3hGH signal sequenceF2AMyc3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterIn lacZ genef1 oriAmpR promoterAmpRoriL4440

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pCCLc-MND-A0201-SABR-Backbone vector Sequence

LOCUS       V001004                10927 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001004
VERSION     V001004
KEYWORDS    pCCLc-MND-A0201-SABR-Backbone
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 10927)
  AUTHORS   Joglekar AV, Leonard MT, Jeppson JD, Swift M, Li G, Wong S, Peng S,
  TITLE     T cell antigen discovery via signaling and antigen-presenting
            bifunctional receptors
  JOURNAL   Nature Methods (2019) volume 16, pages 191–198.
REFERENCE   2  (bases 1 to 10927)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 10927)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nature
            Methods (2019) volume 16, pages 191–198."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10927
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     protein_bind    1..22
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        37..67
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    75..91
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     80..102
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     primer_bind     99..115
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     99..115
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     promoter        136..154
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     enhancer        255..634
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        635..838
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             853..1033
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1080..1205
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1698..1931
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2116..2160
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2309..2350
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2457..2574
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2620..3157
                     /label="MNDU3"
                     /note="The U3 region from the myeloproliferative sarcoma
                     virus (MPSV) LTR with the negative control region (NCR)
                     removed"
     sig_peptide     3177..3254
                     /label="hGH signal sequence"
                     /note="human growth hormone signal sequence"
     CDS             7065..7130
                     /label="F2A"
                     /note="2A peptide from foot-and-mouth disease virus
                     polyprotein"
     CDS             7215..7244
                     /codon_start=1
                     /product="Myc (human c-Myc proto-oncogene) epitope tag"
                     /label="Myc"
                     /translation="EQKLISEEDL"
     LTR             7627..7860
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    7932..8066
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      8093..8228
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(8249..8267)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(8277..8294)
                     /label="M13 Forward"
                     /note="In lacZ gene. Also called M13-F20 or M13 (-21)
                     Forward"
     primer_bind     complement(8277..8293)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(8286..8308)
                     /label="M13/pUC Forward"
                     /note="In lacZ gene"
     rep_origin      8435..8890
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        8916..9020
                     /label="AmpR promoter"
     CDS             9021..9878
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      10052..10640
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     10794..10811
                     /label="L4440"
                     /note="L4440 vector, forward primer"