pCDH-EF1-FHC vector (Cat. No.: V010582)
Note: pCDH-EF1-FHC is a lentiviral expression vector for mammalian cells. It uses the EF1alpha promoter, carries C-terminal FLAG and HA tags, and includes a puromycin resistance gene for selection. Its bacterial backbone has an ampicillin resistance marker.
- Name:
- pCDH-EF1-FHC
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7714 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Promoter:
- RSV
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- EF1a-F_alt (gccgtgaacgttctttttc)
- 3' Primer:
- IRES-R (CCTCACATTGCCAAAAGACG)
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublié S, Johansson E, Ramsden DA, McBride KM, Wood RD. Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. PMID: 25275444; PMCID: PMC4183433.
pCDH-EF1-FHC vector (Cat. No.: V010582) Sequence
LOCUS V010582 7714 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V010582
VERSION V010582
KEYWORDS pCDH-EF1-FHC
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7714)
AUTHORS Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J,
Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD
TITLE Mechanism of suppression of chromosomal instability by DNA
polymerase POLQ.
JOURNAL PLoS Genet. 2014 Oct 2;10(10):e1004654. doi:
10.1371/journal.pgen.1004654. eCollection 2014 Oct.
PUBMED 25275444
REFERENCE 2 (bases 1 to 7714)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7714)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "PLoS
Genet."; date: "2014-10-2"; pages: "
10.1371/journal.pgen.1004654. eCollection 2014 Oct"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7714
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 144..188
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 337..378
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 455..571
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 614..825
/label="EF-1-alpha core promoter"
/note="core promoter for human elongation factor
EF-1-alpha"
LTR 838..1106
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from human
T-cell leukemia virus (HTLV) type 1"
CDS 1178..1201
/label="FLAG"
/note="FLAG(R) epitope tag, followed by an enterokinase
cleavage site"
CDS 1217..1243
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
misc_feature 1254..1826
/label="IRES"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 1835..2431
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature 2441..3029
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 3103..3336
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 3408..3542
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 3569..3704
/label="SV40 ori"
/note="SV40 origin of replication"
primer_bind complement(3737..3753)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(3761..3777)
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(3785..3815)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(3830..3851)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(3968..3985)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(4139..4727)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(4901..5758)
/label="AmpR"
/note="beta-lactamase"
promoter complement(5759..5863)
/label="AmpR promoter"
primer_bind 5931..5949
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
primer_bind complement(5987..6009)
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind 6109..6128
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 6337..6353
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
promoter 6368..6594
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 6595..6775
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 6822..6947
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 7440..7673
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."