FUW-OSKM vector (Cat. No.: V010666)
Note: FUW-OSKM is a FUW-based lentiviral plasmid expressing mouse Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc, used for generating induced pluripotent stem cells.
- Name:
- FUW-OSKM
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12303 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- High copy number
- Promoter:
- UbC
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- ACTTTGCAGCCTGAGGGCCA
- Growth Strain(s):
- Stbl3
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Carey BW, Markoulaki S, Hanna J, Saha K, Gao Q, Mitalipova M, Jaenisch R. Reprogramming of murine and human somatic cells using a single polycistronic vector. Proc Natl Acad Sci U S A. 2009 Jan 6;106(1):157-62. doi: 10.1073/pnas.0811426106. Epub 2008 Dec 24. Erratum in: Proc Natl Acad Sci U S A. 2009 Jul 14;106(28):11818. Erratum in: Proc Natl Acad Sci U S A. 2009 Mar 31;106(13):5449. PMID: 19109433; PMCID: PMC2629226.
FUW-OSKM vector (Cat. No.: V010666) Sequence
LOCUS V010666 12303 bp DNA circular SYN 13-JAN-2022
DEFINITION Exported.
ACCESSION V010666
VERSION V010666
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12303)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 12303)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12303
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 238..617
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 618..820
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 835..1015
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1062..1187
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1686..1919
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2104..2148
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2297..2338
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2446..2563
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
primer_bind 2622..2638
/label="KS primer"
/note="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind 2680..2713
/label="Cre recombinase binding site"
/bound_moiety="Cre recombinase"
/note="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (GCATACAT)."
promoter 2763..3974
/label="UbC promoter"
/note="human ubiquitin C promoter"
CDS 4012..5067
/label="mPou5f1"
/note="Mus musculus Oct-4 gene. Encodes a transcription
factor containing a POU homeodomain that plays a key role
in embryonic development and stem cell pluripotency."
CDS 5083..5139
/codon_start=1
/product="2A peptide from porcine teschovirus-1
polyprotein"
/label="2A peptide from porcine teschovirus-1 polyprotein"
/note="P2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="ATNFSLLKQAGDVEENPGP"
CDS 5146..6102
/label="mSox2"
/note="Mus musculus transcription factor SOX-2 gene.
Belongs to the SRY-related HMG-box (SOX) family of
transcription factors, which is involved in the regulation
of embryonic development and in the determination of cell
fate"
CDS 6118..6171
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="2A peptide from Thosea asigna virus capsid protein"
/note="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 6178..7626
/label="mKlf4"
/note="Mouse Kruppel-like factor (Klf4) gene. Belongs to
the relatively large family of SP1-like transcription
factors and is involved in the regulation of proliferation,
differentiation, apoptosis and somatic cell reprogramming."
CDS 7642..7701
/codon_start=1
/product="2A peptide from equine rhinitis A virus
polyprotein"
/label="2A peptide from equine rhinitis A virus polypro"
/note="E2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="QCTNYALLKLAGDVESNPGP"
CDS 7711..9072
/label="mMyc"
/note="Mus musculus myc proto-oncogene. Belongs to
myelocytomatosis (Myc) family of transcription factors.
Plays a role in cell cycle procession, apotosis and
cellular transformation"
protein_bind complement(9103..9136)
/label="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
misc_feature 9192..9780
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(9783..9799)
/label="KS primer"
/note="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 10309..10489
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(10551..11139)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(11313..12170)
/label="AmpR"
/note="beta-lactamase"
promoter complement(12171..12275)
/label="AmpR promoter"