FUW-OSKM vector (Cat. No.: V010666)

FUW-OSKM12303 bp60012001800240030003600420048005400600066007200780084009000960010200108001140012000CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSKS primerloxPUbC promotermPou5f1P2AmSox2T2AmKlf4E2AmMycloxPWPREKS primer5' LTR (truncated)oriAmpRAmpR promoter
Basic Information
Name:
FUW-OSKM
Antibiotic Resistance:
Ampicillin
Length:
12303 bp
Type:
Lentiviral vectors
Replication origin:
ori
Copy Number:
High copy number
Promoter:
UbC
Cloning Method:
Enzyme digestion and ligation
5' Primer:
ACTTTGCAGCCTGAGGGCCA
$ 248.8
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

FUW-OSKM vector (Cat. No.: V010666) Sequence

LOCUS       V010666                12303 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V010666
VERSION     V010666
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12303)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 12303)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12303
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        238..617
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        618..820
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             835..1015
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1062..1187
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1686..1919
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2104..2148
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2297..2338
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2446..2563
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     primer_bind     2622..2638
                     /label="KS primer"
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    2680..2713
                     /label="Cre recombinase binding site"
                     /bound_moiety="Cre recombinase"
                     /note="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (GCATACAT)."
     promoter        2763..3974
                     /label="UbC promoter"
                     /note="human ubiquitin C promoter"
     CDS             4012..5067
                     /label="mPou5f1"
                     /note="Mus musculus Oct-4 gene. Encodes a transcription
                     factor containing a POU homeodomain that plays a key role
                     in embryonic development and stem cell pluripotency."
     CDS             5083..5139
                     /codon_start=1
                     /product="2A peptide from porcine teschovirus-1
                     polyprotein"
                     /label="2A peptide from porcine teschovirus-1 polyprotein"
                     /note="P2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="ATNFSLLKQAGDVEENPGP"
     CDS             5146..6102
                     /label="mSox2"
                     /note="Mus musculus transcription factor SOX-2 gene.
                     Belongs to the SRY-related HMG-box (SOX) family of
                     transcription factors, which is involved in the regulation
                     of embryonic development and in the determination of cell
                     fate"
     CDS             6118..6171
                     /codon_start=1
                     /product="2A peptide from Thosea asigna virus capsid
                     protein"
                     /label="2A peptide from Thosea asigna virus capsid protein"
                     /note="T2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="EGRGSLLTCGDVEENPGP"
     CDS             6178..7626
                     /label="mKlf4"
                     /note="Mouse Kruppel-like factor (Klf4) gene. Belongs to
                     the relatively large family of SP1-like transcription
                     factors and is involved in the regulation of proliferation,
                     differentiation, apoptosis and somatic cell reprogramming."
     CDS             7642..7701
                     /codon_start=1
                     /product="2A peptide from equine rhinitis A virus
                     polyprotein"
                     /label="2A peptide from equine rhinitis A virus polypro"
                     /note="E2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="QCTNYALLKLAGDVESNPGP"
     CDS             7711..9072
                     /label="mMyc"
                     /note="Mus musculus myc proto-oncogene. Belongs to
                     myelocytomatosis (Myc) family of transcription factors.
                     Plays a role in cell cycle procession, apotosis and
                     cellular transformation"
     protein_bind    complement(9103..9136)
                     /label="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     misc_feature    9192..9780
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(9783..9799)
                     /label="KS primer"
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             10309..10489
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(10551..11139)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(11313..12170)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(12171..12275)
                     /label="AmpR promoter"