Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000178 | pLV-hTERT-IRES-hygro | In stock (lyophilized plasmid) |
Buy one, get one free! |
Two vials of lyophilized plasmid will be delivered, each vial is about 5µg.
Basic Vector Information
- Vector Name:
- pLV-hTERT-IRES-hygro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12531 bp
- Type:
- Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Hygromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- TCAAGCCTCAGACAGTGGTTC
- 3' Primer:
- ACACCGGCCTTATTCCAA
pLV-hTERT-IRES-hygro vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pLV-hTERT-IRES-hygro vector Sequence
LOCUS V000178 12531 bp DNA circular SYN 17-JUN-2021
DEFINITION Exported.
ACCESSION V000178
VERSION V000178
KEYWORDS pLV-hTERT-IRES-hygro.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12531)
AUTHORS Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A,
Betzig E, Meyer T
TITLE Engulfed cadherin fingers are polarized junctional structures
between collectively migrating endothelial cells.
JOURNAL Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub
2016 Nov 14.
PUBMED 27842057
REFERENCE 2 (bases 1 to 12531)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12531)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1038/ncb3438";
journalName: "Nat Cell Biol"; date: "2016-12"; volume: "18"; issue:
"12"; pages: "1311-1323"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12531
/mol_type="other DNA"
/organism="synthetic DNA construct"
LTR 1..634
/label="3' LTR"
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 681..806
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1303..1536
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1721..1765
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1914..1955
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2027..2144
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2207..3380
/label="EF-1-alpha promoter"
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
CDS 3387..6782
/label="hTERT"
/note="human telomerase reverse transcriptase, the
catalytic subunit of telomerase"
misc_feature 6886..7448
/label="IRES"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 7451..8473
/label="HygR"
/note="aminoglycoside phosphotransferase from E. coli"
misc_feature 8500..9088
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 9295..9928
/label="5' LTR"
/note="5' long terminal repeat (LTR) from HIV-1"
primer_bind complement(10056..10072)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(10056..10072)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(10069..10091)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 10080..10096
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(10104..10134)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(10149..10170)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(10287..10304)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(10458..11046)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(11220..12077)
/label="AmpR"
/note="beta-lactamase"
promoter complement(12078..12182)
/label="AmpR promoter"
polyA_signal 12230..12364
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"