Basic Vector Information
- Vector Name:
- pLentiV2-dCas9-VP64
- Antibiotic Resistance:
- Ampicillin
- Length:
- 15499 bp
- Type:
- Gene-editing vector
- Replication origin:
- ori
- Host:
- Mammalian cells, Lentivirus
- Selection Marker:
- Puro
- Promoter:
- EF1a,U6
- 5' Primer:
- G35310-F1:AGGTACCTGAGGTGTGACTG
- Growth Strain(s):
- Stbl3
- Growth Temperature:
- 37℃
pLentiV2-dCas9-VP64 vector Map
pLentiV2-dCas9-VP64 vector Sequence
LOCUS . 15499 bp DNA circular UNK 01-JAN-1980
DEFINITION synthetic circular DNA.
ACCESSION
VERSION
KEYWORDS .
SOURCE .
ORGANISM .
.
FEATURES Location/Qualifiers
enhancer 238..617
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 618..820
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 835..1015
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1062..1187
/label="HIV-1 Ψ"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1680..1913
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2098..2142
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2291..2332
/gene="Protein Tat"
/label="Protein Tat"
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 2440..2557
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2608..2848
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 4738..4813
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
promoter 4875..5086
/label="EF-1α core promoter"
/note="core promoter for human elongation factor EF-1α"
CDS 5151..9251
/label="dCas9"
/note="catalytically dead mutant of the Cas9 endonuclease
from the Streptococcus pyogenes Type II CRISPR/Cas system"
CDS 9306..9326
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 9351..9500
/label="VP64"
/note="tetrameric repeat of the minimal activation domain
of herpes simplex virus VP16 (Beerli et al., 1998)"
CDS 9522..9578
/label="P2A"
/note="2A peptide from porcine teschovirus-1 polyprotein"
CDS 9579..10172
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature 10191..10779
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 11304..11484
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 11516..11740
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 11786..12214
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 12228..12557
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 12605..12652
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 12671..13042
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 13175..13308
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
promoter complement(13393..13423)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(13438..13459)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(13747..14335)
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(14509..15366)
/label="AmpR"
/note="β-lactamase"
promoter complement(15367..15471)
/label="AmpR promoter"
This page is informational only.