Basic Vector Information
- Vector Name:
- pGAP-TurboRFP-URA3
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7313 bp
- Type:
- Protein expression
- Replication origin:
- ori
- Host:
- Yeast
- Selection Marker:
- URA3
- Promoter:
- GAP
- 5' Primer:
- TurboRFP-R2:CCGTCTTCGTATGTGGTGAT
- Growth Strain(s):
- Stbl3
- Growth Temperature:
- 37℃
pGAP-TurboRFP-URA3 vector Map
pGAP-TurboRFP-URA3 vector Sequence
LOCUS . 7313 bp DNA circular UNK 01-JAN-1980
DEFINITION synthetic circular DNA.
ACCESSION
VERSION
KEYWORDS .
SOURCE .
ORGANISM .
.
FEATURES Location/Qualifiers
CDS 1..693
/label="TurboRFP"
/note="red fluorescent protein from Entacmaea quadricolor"
terminator 715..902
/label="ADH1 terminator"
/note="transcription terminator for the S. cerevisiae
alcohol dehydrogenase 1 (ADH1) gene"
promoter complement(940..958)
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
primer_bind complement(979..995)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(1003..1019)
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-β-D-thiogalactopyranoside (IPTG)."
promoter complement(1027..1057)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(1072..1093)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(1381..1969)
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(2143..3000)
/label="AmpR"
/note="β-lactamase"
promoter complement(3001..3105)
/label="AmpR promoter"
rep_origin complement(3132..4474)
/label="2μ ori"
/note="yeast 2μ plasmid origin of replication"
promoter 4736..4951
/label="URA3 promoter"
CDS 4952..5752
/label="URA3"
/note="orotidine-5'-phosphate decarboxylase, required for
uracil biosynthesis"
rep_origin complement(5886..6341)
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
primer_bind 6482..6498
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
promoter 6508..6526
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind 6552..6568
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
promoter 6613..7279
/label="GAP promoter"
/note="promoter for glyceraldehyde-3-phosphate
dehydrogenase; also known as the TDH3 promoter"
This page is informational only.