Basic Vector Information
- Vector Name:
- pLemiR-NS
- Antibiotic Resistance:
- Ampicillin
- Length:
- 11662 bp
- Type:
- Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Ligation Independent Cloning
- 5' Primer:
- GATAACTCGACTGTTTGAATGAGGC
- 3' Primer:
- AGGGAGAGGGGCGGAATTTG
pLemiR-NS vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pLemiR-NS vector Sequence
LOCUS pLemiR-NS. 11662 bp DNA circular SYN 13-MAY-2021
DEFINITION synthetic circular DNA.
ACCESSION .
VERSION .
KEYWORDS pLemiR-NS.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 11662)
AUTHORS Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer
C, Dolmetsch RE, Tsien RW, Crabtree GR
TITLE MicroRNA-mediated conversion of human fibroblasts to neurons.
JOURNAL Nature. 2011 Jul 13. doi: 10.1038/nature10323.
PUBMED 21753754
REFERENCE 2 (bases 1 to 11662)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 11662)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nature.
2011 Jul 13. doi: 10.1038/nature10323."
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..11662
/mol_type="other DNA"
/organism="synthetic DNA construct"
LTR 1..634
/label=3' LTR
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 681..806
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1303..1536
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1721..1765
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1914..1955
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 2063..2180
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
CDS complement(2248..2619)
/label=BleoR
/note="antibiotic-binding protein"
promoter complement(2639..2686)
/label=EM7 promoter
/note="synthetic bacterial promoter"
enhancer 2753..3056
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 3057..3260
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
primer_bind 3257..3281
/label=LNCX
/note="Human CMV promoter, forward primer"
CDS 3364..4056
/label=TurboRFP
/note="red fluorescent protein from Entacmaea quadricolor"
ncRNA 4069..4190
/label=5' miR-30a
/note="sequence upstream of the 71-nt precursor of the
human miR-30a microRNA (Zeng et al., 2002)"
ncRNA 4218..4232
/label=miR-30a loop
/note="loop from the the 71-nt precursor of the human
miR-30a microRNA (Zeng et al., 2002)"
/ncRNA_class="miRNA"
ncRNA 4260..4386
/label=3' miR-30a
/note="sequence downstream of the 71-nt precursor of the
human miR-30a microRNA (Zeng et al., 2002)"
misc_feature 4440..5022
/label=IRES2
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 5021..5614
/label=PuroR
/note="puromycin N-acetyltransferase"
misc_feature 5633..6221
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 6428..6661
/label=3' LTR (Delta-U3)
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 6768..6992
/label=bGH poly(A) signal
/note="bovine growth hormone polyadenylation signal"
rep_origin 7038..7466
/label=f1 ori
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 7480..7809
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
polyA_signal 9017..9150
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
primer_bind complement(9187..9203)
/label=M13 rev
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(9187..9203)
/label=M13 Reverse
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(9200..9222)
/label=M13/pUC Reverse
/note="In lacZ gene"
protein_bind 9211..9227
/label=lac operator
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(9235..9265)
/label=lac promoter
/note="promoter for the E. coli lac operon"
protein_bind complement(9280..9301)
/label=CAP binding site
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(9418..9435)
/label=L4440
/note="L4440 vector, forward primer"
rep_origin complement(9589..10177)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(10351..11208)
/label=AmpR
/note="beta-lactamase"
promoter complement(11209..11313)
/label=AmpR promoter
polyA_signal 11361..11495
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
This page is informational only.