Basic Vector Information
- Vector Name:
- FUW_tetO_GFP_hOKMS
- Antibiotic Resistance:
- Ampicillin
- Length:
- 14810 bp
- Type:
- Protein expression
- Replication origin:
- ori
- Host:
- Mammalian cells, Lentivirus
- Promoter:
- SV40
- 5' Primer:
- SV40pro-F：TATTTATGCAGAGGCCGAGG
- 3' Primer:
- WPRE-R：CATAGCGTAAAAGGAGCAACA
- Growth Temperature:
- 37℃
FUW_tetO_GFP_hOKMS vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
FUW_tetO_GFP_hOKMS vector Sequence
LOCUS 62056_926 14810 bp DNA circular SYN 01-JAN-1980
DEFINITION synthetic circular DNA.
ACCESSION .
VERSION .
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 14810)
AUTHORS .
TITLE Direct Submission
FEATURES Location/Qualifiers
source 1..14810
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 7..386
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 387..589
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 604..784
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 831..956
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1449..1682
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1867..1911
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2060..2101
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 2209..2326
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
protein_bind 2385..2655
/label=tetracycline response element
/note="contains seven copies of the tetracycline operator
tetO"
CDS 2869..3585
/label=EGFP
/note="enhanced GFP"
misc_feature 3700..4273
/label=IRES
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 4280..5359
/label=hOct4
/note="Homo sapiens Oct-4 gene. Encodes a transcription
factor containing a POU homeodomain that plays a key role
in embryonic development and stem cell pluripotency.
Aberrant expression in adult tissues is associated with
tumorigenesis."
CDS 5423..6832
/label=hKLF4
/note="Homo sapiens Kruppel-like factor 4 (Klf4) gene.
Belongs to the relatively large family of SP1-like
transcription factors and is involved in the regulation of
proliferation, differentiation, apoptosis and somatic cell
reprogramming."
CDS 6899..8215
/label=c-Myc
/note="human c-Myc proto-oncogene"
CDS 8285..9235
/label=hSOX2
/note="Homo sapiens transcription factor SOX-2 gene.
Belongs to the SRY-related HMG-box (SOX) family of
transcription factors, which is involved in the regulation
of embryonic development and in the determination of cell
fate"
misc_feature 9271..9859
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 10384..10564
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 10596..10820
/label=bGH poly(A) signal
/note="bovine growth hormone polyadenylation signal"
rep_origin 10866..11294
/label=f1 ori
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 11308..11637
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
promoter 11685..11732
/label=EM7 promoter
/note="synthetic bacterial promoter"
CDS 11751..12122
/label=BleoR
/note="antibiotic-binding protein"
polyA_signal 12255..12388
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
promoter complement(12473..12503)
/label=lac promoter
/note="promoter for the E. coli lac operon"
protein_bind complement(12518..12539)
/label=CAP binding site
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(12827..13415)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(13589..14446)
/label=AmpR
/note="beta-lactamase"
promoter complement(14447..14551)
/label=AmpR promoter
This page is informational only.