Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V014991 | FUW_tetO_GFP_hOKMS | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- FUW_tetO_GFP_hOKMS
- Antibiotic Resistance:
- Ampicillin
- Length:
- 14810 bp
- Type:
- Protein expression
- Replication origin:
- ori
- Host:
- Mammalian cells, Lentivirus
- Promoter:
- SV40
- 5' Primer:
- SV40pro-F：TATTTATGCAGAGGCCGAGG
- 3' Primer:
- WPRE-R：CATAGCGTAAAAGGAGCAACA
- Growth Temperature:
- 37℃
FUW_tetO_GFP_hOKMS vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
FUW_tetO_GFP_hOKMS vector Sequence
LOCUS V014991 14810 bp DNA circular SYN 01-JAN-1980
DEFINITION Exported.
ACCESSION V014991
VERSION V014991
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 14810)
AUTHORS .
TITLE Direct Submission
FEATURES Location/Qualifiers
source 1..14810
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 7..386
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 387..589
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 604..784
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 831..956
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1449..1682
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1867..1911
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2060..2101
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2209..2326
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
protein_bind 2385..2655
/label="tetracycline response element"
/note="contains seven copies of the tetracycline operator
tetO"
CDS 2869..3585
/label="EGFP"
/note="enhanced GFP"
misc_feature 3700..4273
/label="IRES"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 4280..5359
/label="hOct4"
/note="Homo sapiens Oct-4 gene. Encodes a transcription
factor containing a POU homeodomain that plays a key role
in embryonic development and stem cell pluripotency.
Aberrant expression in adult tissues is associated with
tumorigenesis."
CDS 5423..6832
/label="hKLF4"
/note="Homo sapiens Kruppel-like factor 4 (Klf4) gene.
Belongs to the relatively large family of SP1-like
transcription factors and is involved in the regulation of
proliferation, differentiation, apoptosis and somatic cell
reprogramming."
CDS 6899..8215
/label="c-Myc"
/note="human c-Myc proto-oncogene"
CDS 8285..9235
/label="hSOX2"
/note="Homo sapiens transcription factor SOX-2 gene.
Belongs to the SRY-related HMG-box (SOX) family of
transcription factors, which is involved in the regulation
of embryonic development and in the determination of cell
fate"
misc_feature 9271..9859
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 10384..10564
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 10596..10820
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 10866..11294
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 11308..11637
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 11685..11732
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 11751..12122
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 12255..12388
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
promoter complement(12473..12503)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(12518..12539)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(12827..13415)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(13589..14446)
/label="AmpR"
/note="beta-lactamase"
promoter complement(14447..14551)
/label="AmpR promoter"