pET_His6-SUMO-TEV-TtCsm6 vector (V014464)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V014464 pET_His6-SUMO-TEV-TtCsm6 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pET_His6-SUMO-TEV-TtCsm6
Antibiotic Resistance:
Kanamycin
Length:
7057 bp
Type:
Protein expression
Replication origin:
ori
Host:
E. coli
Promoter:
T7
5' Primer:
T7:TAATACGACTCACTATAGGG
Growth Temperature:
37℃

pET_His6-SUMO-TEV-TtCsm6 vector Map

pET_His6-SUMO-TEV-TtCsm67057 bp30060090012001500180021002400270030003300360039004200450048005100540057006000630066006900lacIlacI promoterT7 promoterlac operatorRBS6xHisSUMOTEV siteCRISPR system endoribonuclease Csm66xHisT7 terminatorf1 oriKanRoribomropCAP binding site

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pET_His6-SUMO-TEV-TtCsm6 vector Sequence

LOCUS       V014464                 7057 bp    DNA     circular SYN 01-JAN-1980
DEFINITION  Exported.
ACCESSION   V014464
VERSION     V014464
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7057)
  AUTHORS   .
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..7057
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        complement(1012..1089)
                     /label="lacI promoter"
     promoter        1398..1416
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    1417..1441
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             1456..1478
                     /label="RBS"
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     CDS             1497..1514
                     /label="6xHis"
                     /note="6xHis affinity tag"
     CDS             1533..1826
                     /label="SUMO"
                     /note="cleavable ubiquitin-like protein tag"
     CDS             1833..1853
                     /label="TEV site"
                     /note="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
     CDS             1860..3248
                     /gene="csm6"
                     /label="CRISPR system endoribonuclease Csm6"
                     /note="CRISPR system endoribonuclease Csm6 from Thermus
                     thermophilus (strain ATCC 27634 / DSM 579 / HB8).
                     Accession#: Q53W17"
     CDS             3318..3335
                     /label="6xHis"
                     /note="6xHis affinity tag"
     terminator      3402..3449
                     /label="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
                     polymerase"
     rep_origin      3486..3941
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     CDS             complement(4037..4849)
                     /label="KanR"
                     /note="aminoglycoside phosphotransferase"
     rep_origin      4971..5559
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     misc_feature    complement(5745..5884)
                     /label="bom"
                     /note="basis of mobility region from pBR322"
     CDS             complement(5989..6177)
                     /label="rop"
                     /note="Rop protein, which maintains plasmids at low copy
                     number"
     protein_bind    complement(6952..6973)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     CDS             complement(join(6989..7057,1..1011))
                     /label="lacI"
                     /note="lac repressor"