pMIB/V5-His A vector (V011609)

MSDS

Basic Vector Information

Vector Name:: pMIB/V5-His A

Antibiotic Resistance:: Ampicillin

Length:: 3596 bp

Type:: Insect Cell Vectors

Replication origin:: ori

Source/Author:: Invitrogen (Life Technologies)

Selection Marker:: Blasticidin

Copy Number:: High copy number

Promoter:: OpIE-2

5' Primer:: OpIE2-F: 5'd[CGCAACGATCTGGTAAACAC]3'

Fusion Tag:: HBM (Nterm), V5 (Cterm), His (Cterm)

pMIB/V5-His A vector Vector Map

View Map in NovoBuilder

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

pMIB/V5-His A vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       pMIB_V5-His_A.        3596 bp DNA     circular SYN 01-JAN-1980
DEFINITION  Insect cell vector for expression of secreted, C-terminally 
            V5-6xHis-tagged proteins. For other reading frames, use pMIB/V5-His 
            B or pMIB/V5-His C.
ACCESSION   .
VERSION     .
KEYWORDS    pMIB V5-His A.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3596)
  AUTHORS   Invitrogen (Life Technologies)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 3596)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..3596
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        1..548
                     /label=OpIE-2 promoter
                     /note="strong constitutive baculovirus promoter for insect
                     cell expression"
     sig_peptide     565..627
                     /label=melittin signal sequence
                     /note="signal sequence from honeybee melittin"
     misc_feature    629..721
                     /label=MCS
                     /note="MCS"
                     /note="multiple cloning site"
     CDS             734..775
                     /label=V5 tag
                     /note="epitope tag from simian virus 5"
     CDS             785..802
                     /label=6xHis
                     /note="6xHis affinity tag"
     polyA_signal    820..949
                     /label=OpIE-2 poly(A) signal
                     /note="baculovirus polyadenylation signal"
     rep_origin      complement(1077..1665)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     promoter        1740..2031
                     /label=OpIE-1 promoter
                     /note="moderate constitutive baculovirus promoter for
                     insect cell expression"
     promoter        2057..2104
                     /label=EM7 promoter
                     /note="synthetic bacterial promoter"
     CDS             2123..2518
                     /label=BSD
                     /note="blasticidin S deaminase"
     CDS             2641..3498
                     /label=AmpR
                     /note="beta-lactamase"

This page is informational only.