pGEX-6P-1 vector (V010912)

Price Information

Cat No. Plasmid Name Availability Add to cart
V010912 pGEX-6P-1 In stock (lyophilized plasmid)

Buy one, get one free!

Two vials of lyophilized plasmid will be delivered, each vial is about 5µg.

Basic Vector Information

The pGEX-6P-1 is a bacterial vector for expressing GST fusion proteins with a PreScission protease site. For other reading frames, use pGEX-6P-2 or pGEX-6P-3.

      • Vector Name:
      • pGEX-6P-1
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 4984 bp
      • Type:
      • pGEX Vectors (GE Healthcare)
      • Source/Author:
      • GE Healthcare
      • Copy Number:
      • High copy number
      • Promoter:
      • Tac
      • 5' Primer:
      • GGGCTGGCAAGCCACGTTTGGTG
      • 3' Primer:
      • CCGGGAGCTGCATGTGTCAGAGG
      • Fusion Tag:
      • N-GST
      • Growth Temperature:
      • 37℃

pGEX-6P-1 vector Vector Map

pGEX-6P-14984 bp6001200180024003000360042004800tac promoterlac operatorGSTHRV 3C sitestop codonsAmpR promoterAmpRorilacIq promoterlacICAP binding sitelac promoterlacZ-alpha

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

References

  • Huynh TN, Ren X. Producing GST-Cbx7 Fusion Proteins from Escherichia coli. Bio Protoc. 2017 Jun 20;7(12):e2333. doi: 10.21769/BioProtoc.2333. PMID: 28966944; PMCID: PMC5621756.

pGEX-6P-1 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       pGEX-6P-1.        4984 bp DNA     circular SYN 01-JAN-1980
DEFINITION  Bacterial vector for expressing GST fusion proteins with a 
            PreScission protease site. For other reading frames, use pGEX-6P-2 
            or pGEX-6P-3.
ACCESSION   .
VERSION     .
KEYWORDS    pGEX-6P-1.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4984)
  AUTHORS   GE Healthcare
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 4984)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..4984
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        183..211
                     /label=tac promoter
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac UV5 promoters"
     protein_bind    219..235
                     /label=lac operator
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             258..911
                     /label=GST
                     /note="glutathione S-transferase from Schistosoma
                     japonicum"
     CDS             918..941
                     /label=HRV 3C site
                     /note="recognition and cleavage site for human rhinovirus
                     3C and PreScission proteases"
     misc_feature    940..981
                     /label=MCS
                     /note="MCS"
                     /note="multiple cloning site"
     misc_feature    986..996
                     /label=stop codons
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     promoter        1287..1391
                     /label=AmpR promoter
     CDS             1392..2249
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      2423..3011
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     promoter        3255..3332
                     /label=lacIq promoter
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3333..4412
                     /label=lacI
                     /note="lac repressor"
     protein_bind    4428..4449
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4464..4494
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     CDS             4538..4711
                     /label=lacZ-alpha
                     /note="LacZ-alpha fragment of beta-galactosidase"