NovoPro
Cart 2
  • vps36 Zebrafish  cDNA/ORF Clones

vps36 Zebrafish cDNA/ORF Clones

Cat.#: 738564-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 215.4 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    vacuolar protein sorting 36 homolog (S. cerevisiae)
  • Organism
    Zebrafish
  • Entrez Gene ID
  • Gene Symbol
    vps36
  • Gene Type
    protein coding
  • Also Known as
    fj33d07; zgc:55965; wu:fj33d07
  • Encoded Protein Alias
    ESCRT-II complex subunit VPS36
  • Product Name
    vps36(NM_199977) Zebrafish cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Danio rerio vacuolar protein sorting 36 homolog (S. cerevisiae) (vps36), mRNA.
  • Synonyms
  • ORF length
    1149
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"