NovoPro
Cart 2
  • ATP6V1E1 Macaca fascicularis  cDNA/ORF Clones

ATP6V1E1 Macaca fascicularis cDNA/ORF Clones

Cat.#: 700018-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 127.7 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ATPase H+ transporting V1 subunit E1
  • Organism
    Macaca fascicularis
  • Entrez Gene ID
  • Gene Symbol
    ATP6V1E1
  • Gene Type
    protein coding
  • Encoded Protein Alias
    V-type proton ATPase subunit E 1; V-ATPase subunit E 1; Vacuolar proton pump subunit E 1
  • Product Name
    ATP6V1E1(NM_001283521) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Macaca fascicularis ATPase H+ transporting V1 subunit E1 (ATP6V1E1), mRNA.
  • Synonyms
  • ORF length
    681
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"