NovoPro
Cart 2
  • SULT4A1 Rhesus Monkey  cDNA/ORF Clones

SULT4A1 Rhesus Monkey cDNA/ORF Clones

Cat.#: 700129-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 160.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    sulfotransferase family 4A member 1
  • Organism
    Rhesus Monkey
  • Entrez Gene ID
  • Gene Symbol
    SULT4A1
  • Gene Type
    protein coding
  • Encoded Protein Alias
    uncharacterized LOC100428737
  • Product Name
    SULT4A1(XM_015150530) Rhesus Monkey cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca mulatta sulfotransferase family 4A member 1 (SULT4A1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    855
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"