NovoPro
Cart 2
  • UBE2S Human  cDNA/ORF Clones

UBE2S Human cDNA/ORF Clones

Cat.#: 707800-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ubiquitin conjugating enzyme E2 S
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    UBE2S
  • Gene Type
    protein coding
  • Also Known as
    EPF5; E2EPF; E2-EPF
  • Encoded Protein Alias
    ubiquitin-conjugating enzyme E2 S; E2-EPF5; ubiquitin carrier protein S; ubiquitin-conjugating enzyme E2-24 kD; ubiquitin-conjugating enzyme E2-24 kDa; ubiquitin-conjugating enzyme E2-EPF5; ubiquitin-protein ligase S
  • Product Name
    UBE2S(XM_011526752) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ubiquitin conjugating enzyme E2 S (UBE2S), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    489
  • siRNA

    AGGUCUUUCCCAACGAGGAtt

    UGACGACACUGACCGCAGAtt

    CCCAAGGGCUACUUCCUGAtt

    CCAAGAUCUUCCACCCGAAtt

  • DataSheet:
  • Product Name
    UBE2S(NM_014501) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens ubiquitin conjugating enzyme E2 S (UBE2S), mRNA.
  • Synonyms
  • ORF length
    669
  • siRNA

    AGAAAAAGACGGACAAGAAtt

    AGGUCUUUCCCAACGAGGAtt

    GCCUGCUGAUCCACCCUAAtt

    UGACGACACUGACCGCAGAtt

    CCCAAGGGCUACUUCCUGAtt

    CCAAGAUCUUCCACCCGAAtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"