NovoPro
Cart 2
  • TYROBP Chimpanzee  cDNA/ORF Clones

TYROBP Chimpanzee cDNA/ORF Clones

Cat.#: 732499-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    TYRO protein tyrosine kinase binding protein
  • Organism
    Chimpanzee
  • Entrez Gene ID
  • Gene Symbol
    TYROBP
  • Gene Type
    protein coding
  • Encoded Protein Alias
    tyrosine kinase binding protein
  • Product Name
    TYROBP(XM_016934049) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    318
  • DataSheet:
  • Product Name
    TYROBP(NM_001083623) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), mRNA.
  • Synonyms
  • ORF length
    342
  • DataSheet:
  • Product Name
    TYROBP(XM_016934048) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    435
  • DataSheet:
  • Product Name
    TYROBP(XM_009435361) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    339
  • DataSheet:
  • Product Name
    TYROBP(XM_016934052) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    282
  • DataSheet:
  • Product Name
    TYROBP(XM_016934051) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    285
  • DataSheet:
  • Product Name
    TYROBP(XM_016934050) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    315
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"