NovoPro
Cart 2
  • Tlr7 Mouse  cDNA/ORF Clones

Tlr7 Mouse cDNA/ORF Clones

Cat.#: 702842-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 291.2 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    toll-like receptor 7
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Tlr7
  • Gene Type
    protein coding
  • Encoded Protein Alias
    toll-like receptor 7
  • Product Name
    Tlr7(NM_001290758) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus toll-like receptor 7 (Tlr7), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    3162
  • Annotation
    This variant (5) lacks an alternate exon in the 5' region and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is longer than isoform a.
  • siRNA

    GCCUUACACUAUUUCCGAUtt

    CCAUAUCCGUGUACACCGUtt

    GCUCUAUCUUUAUAACAAUtt

  • DataSheet:
  • Vector Name
    pEXP-SP-N-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6061
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"