NovoPro
Cart 2
  • TNFRSF11B Cattle  cDNA/ORF Clones

TNFRSF11B Cattle cDNA/ORF Clones

Cat.#: 732962-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 207.2 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    TNF receptor superfamily member 11b
  • Organism
    Cattle
  • Entrez Gene ID
  • Gene Symbol
    TNFRSF11B
  • Gene Type
    protein coding
  • Encoded Protein Alias
    osteoprotegerin; tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"