NovoPro
Cart 2
  • Tspan31 Rat  cDNA/ORF Clones

Tspan31 Rat cDNA/ORF Clones

Cat.#: 700962-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    tetraspanin 31
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Tspan31
  • Gene Type
    protein coding
  • Also Known as
    Sas
  • Encoded Protein Alias
    tetraspanin-31; sarcoma amplified sequence; sarcoma-amplified sequence homolog; tspan-31
  • Product Name
    Tspan31(XM_017594923) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus tetraspanin 31 (Tspan31), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    588
  • siRNA
  • DataSheet:
  • Product Name
    Tspan31(NM_001008378) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus tetraspanin 31 (Tspan31), mRNA.
  • Synonyms
    XM_343217  
  • ORF length
    633
  • siRNA

    UGUGGUUUGUUUAACCUUAtt

    GAGACAUUCCUAAAACAUUtt

    CAACGUGGUUUAUAUGCUUtt

  • DataSheet:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"