NovoPro
Cart 2
  • TCTN3 Human  cDNA/ORF Clones

TCTN3 Human cDNA/ORF Clones

Cat.#: 707940-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 298.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    tectonic family member 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TCTN3
  • Gene Type
    protein coding
  • Also Known as
    OFD4; TECT3; JBTS18; C10orf61
  • Encoded Protein Alias
    tectonic-3
  • Product Name
    TCTN3(XM_011539628) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens tectonic family member 3 (TCTN3), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1740
  • siRNA

    GGACUUUUGGAAUCCAGAAtt

    CCUAGAGAGUAAAAGUACAtt

    GCUUCAAAAGGUCAAUGCAtt

  • DataSheet:
  • Product Name
    TCTN3(XM_005269690) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens tectonic family member 3 (TCTN3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1797
  • siRNA

    GGACUUUUGGAAUCCAGAAtt

    CCUAGAGAGUAAAAGUACAtt

    GCUUCAAAAGGUCAAUGCAtt

  • DataSheet:
  • Product Name
    TCTN3(NM_015631) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens tectonic family member 3 (TCTN3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1824
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (a).
  • siRNA

    GGACUUUUGGAAUCCAGAAtt

    CCUAGAGAGUAAAAGUACAtt

    GCUUCAAAAGGUCAAUGCAtt

  • DataSheet:
  • Product Name
    TCTN3(NM_001143973) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens tectonic family member 3 (TCTN3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1380
  • Annotation
    This variant (2) lacks four alternate exons in the mid coding region, compared to variant 1, which results in the loss of two in-frame segments. The resulting isoform (b) is shorter than isoform a.
  • siRNA

    CCUAGAGAGUAAAAGUACAtt

  • DataSheet:
  • Product Name
    TCTN3(XM_011539627) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens tectonic family member 3 (TCTN3), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1863
  • siRNA

    GGACUUUUGGAAUCCAGAAtt

    CCUAGAGAGUAAAAGUACAtt

    GCUUCAAAAGGUCAAUGCAtt

  • DataSheet:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"