NovoPro
Cart 2
  • TBRG1 Human  cDNA/ORF Clones

TBRG1 Human cDNA/ORF Clones

Cat.#: 719232-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 191.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    transforming growth factor beta regulator 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TBRG1
  • Gene Type
    protein coding
  • Also Known as
    NIAM; TB-5
  • Encoded Protein Alias
    nuclear interactor of ARF and MDM2
  • Product Name
    TBRG1(NM_032811) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens transforming growth factor beta regulator 1 (TBRG1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1236
  • Annotation
    This variant (1) represents the longer, protein-coding transcript.
  • siRNA

    GCCUCAGUUUGAAAUUGUUtt

    GGACUAUAAGCACUACUAUtt

    CAUGAACCCUUGGUAGAUAtt

    GAACUGCUCAGGACUAUAAtt

  • DataSheet:
  • Product Name
    TBRG1(XM_017018442) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens transforming growth factor beta regulator 1 (TBRG1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    783
  • siRNA

    CAACAAACUGGAAGAUCAUtt

    GCCUCAGUUUGAAAUUGUUtt

    GGACUAUAAGCACUACUAUtt

    CAUGAACCCUUGGUAGAUAtt

    GAACUGCUCAGGACUAUAAtt

  • DataSheet:
  • Product Name
    TBRG1(XM_005271709) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens transforming growth factor beta regulator 1 (TBRG1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    795
  • siRNA

    GCCUCAGUUUGAAAUUGUUtt

    GGACUAUAAGCACUACUAUtt

    CAUGAACCCUUGGUAGAUAtt

    GAACUGCUCAGGACUAUAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"