NovoPro
Cart 2
  • ST7L Cattle  cDNA/ORF Clones

ST7L Cattle cDNA/ORF Clones

Cat.#: 733056-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 330.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    suppression of tumorigenicity 7 like
  • Organism
    Cattle
  • Entrez Gene ID
  • Gene Symbol
    ST7L
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Suppressor of tumorigenicity protein 7-like protein
  • Product Name
    ST7L(XM_010803190) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1761
  • DataSheet:
  • Product Name
    ST7L(XM_010803194) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1647
  • DataSheet:
  • Product Name
    ST7L(XM_010803189) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1770
  • DataSheet:
  • Product Name
    ST7L(XM_010803196) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    1587
  • DataSheet:
  • Product Name
    ST7L(XM_015463815) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    1404
  • DataSheet:
  • Product Name
    ST7L(XM_010803188) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1782
  • DataSheet:
  • Product Name
    ST7L(XM_010803193) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1686
  • DataSheet:
  • Product Name
    ST7L(XM_005204136) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1695
  • DataSheet:
  • Product Name
    ST7L(XM_010803195) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1635
  • DataSheet:
  • Product Name
    ST7L(XM_015463795) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1809
  • DataSheet:
  • Product Name
    ST7L(XM_010803192) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1707
  • DataSheet:
  • Product Name
    ST7L(XM_010803186) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1818
  • DataSheet:
  • Product Name
    ST7L(XM_010803191) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1743
  • DataSheet:
  • Product Name
    ST7L(XM_010803198) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1428
  • DataSheet:
  • Product Name
    ST7L(XM_010803197) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus suppression of tumorigenicity 7 like (ST7L), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1566
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"