NovoPro
Cart 2
  • SPIN1 Pongo abelii  cDNA/ORF Clones

SPIN1 Pongo abelii cDNA/ORF Clones

Cat.#: 719306-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    spindlin 1
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    SPIN1
  • Gene Type
    protein coding
  • Also Known as
    SPIN; Spindlin-1
  • Encoded Protein Alias
    spindlin1
  • Product Name
    SPIN1(XM_009244598) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii spindlin 1 (SPIN1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    714
  • siRNA
  • DataSheet:
  • Product Name
    SPIN1(NM_001132974) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii spindlin 1 (SPIN1), mRNA.
  • Synonyms
  • ORF length
    789
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"