Cart 2
  • SLC25A23 Human  cDNA/ORF Clone

SLC25A23 Human cDNA/ORF Clone

Cat.#: 750170-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 288.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 25 member 23
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    SLC25A23
  • Gene Type
    protein coding
  • Also Known as
    APC2; MCSC2; SCaMC-3
  • Encoded Protein Alias
    mitochondrial ATP-Mg/Pi carrier protein 2; mitochondrial Ca(2+)-dependent solute carrier protein 2; mitochondrial Ca2+-dependent solute carrier protein 2; short calcium-binding mitochondrial carrier 3; small calcium-binding mitochondrial carrier protein 3; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
  • Product Name
    SLC25A23(XM_011528277) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1683
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528281) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1548
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528283) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1473
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528276) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1707
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_017027288) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1455
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528275) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1734
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528280) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1596
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_017027286) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1566
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_017027292) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    1101
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528284) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1410
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_017027290) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1239
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528285) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    1380
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528274) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1875
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528278) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1650
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_017027285) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1689
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(NM_024103) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens solute carrier family 25 member 23 (SLC25A23), mRNA.
  • Synonyms
  • ORF length
    1407
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC25A23(XM_011528282) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 25 member 23 (SLC25A23), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1512
  • siRNA

    GAGAAAAUUUUGCACAGCAtt

    UGAUGUCUCUGAGAUCCAAtt

    AAACCAUCAUUUACCCUAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"