NovoPro
Cart 2
  • Slc25a12 Mouse  cDNA/ORF Clones

Slc25a12 Mouse cDNA/ORF Clones

Cat.#: 743912-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 258.6 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 25 (mitochondrial carrier, Aralar), member 12
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Slc25a12
  • Gene Type
    protein coding
  • Also Known as
    AI839531; BB129864; 2610002D09Rik; B230107K20Rik
  • Encoded Protein Alias
    mitochondrial aspartate glutamate carrier 1; solute carrier family 25 member 12
  • Product Name
    Slc25a12(XM_006500420) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus solute carrier family 25 (mitochondrial carrier, Aralar), member 12 (Slc25a12), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1509
  • siRNA
  • DataSheet:
  • Product Name
    Slc25a12(NM_172436) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus solute carrier family 25 (mitochondrial carrier, Aralar), member 12 (Slc25a12), mRNA.
  • Synonyms
  • ORF length
    2034
  • siRNA

    GCCUUUGCACUGAAAGACAtt

    GAGUAGCUGAUCAAACCAAtt

    CACUAGAAAUUGAUAUCUUtt

  • DataSheet:
  • Product Name
    Slc25a12(XM_011239853) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus solute carrier family 25 (mitochondrial carrier, Aralar), member 12 (Slc25a12), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1767
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"