NovoPro
Cart 2
  • SLC22A1 Cattle  cDNA/ORF Clones

SLC22A1 Cattle cDNA/ORF Clones

Cat.#: 733010-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 317.3 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 22 member 1
  • Organism
    Cattle
  • Entrez Gene ID
  • Gene Symbol
    SLC22A1
  • Gene Type
    protein coding
  • Also Known as
    OCT1
  • Encoded Protein Alias
    organic cation transporter 1
  • Product Name
    SLC22A1(XM_015472927) Cattle cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Bos taurus solute carrier family 22 (organic cation transporter), member 1 (SLC22A1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1692
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"