NovoPro
Cart 2
  • Sirpa Mouse  cDNA/ORF Clones

Sirpa Mouse cDNA/ORF Clones

Cat.#: 709267-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    signal-regulatory protein alpha
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Sirpa
  • Gene Type
    protein coding
  • Also Known as
    Bit; P84; SIRP; SHP-1; CD172a; Ptpns1; SHPS-1; AI835480
  • Encoded Protein Alias
    tyrosine-protein phosphatase non-receptor type substrate 1; CD172 antigen-like family member A; SHP substrate 1; brain Ig-like molecule with tyrosine-based activation motifs; brain immunological-like with tyrosine-based motifs; inhibitory receptor SHPS-1; mSIRP-alpha1; myD-1 antigen; protein tyrosine phosphatase, non-receptor type substrate 1; signal-regulatory protein alpha-1; sirp-alpha-1
  • Product Name
    Sirpa(NM_001291022) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus signal-regulatory protein alpha (Sirpa), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    519
  • Annotation
    This variant (7) lacks an alternate in-frame exon in the 5' coding region and two in-frame exons in the central coding region, and also uses an alternate in-frame splice site in the 3' coding region, compared to variant 4. The encoded isoform (5) is shorter than isoform 3.
  • siRNA
  • DataSheet:
  • Product Name
    Sirpa(XM_017316564) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus signal-regulatory protein alpha (Sirpa), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1521
  • siRNA
  • DataSheet:
  • Product Name
    Sirpa(NM_001291021) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus signal-regulatory protein alpha (Sirpa), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    888
  • Annotation
    This variant (6) lacks two alternate in-frame exons in the central coding region, compared to variant 4, resulting in an isoform (4) that is shorter than isoform 3.
  • siRNA
  • DataSheet:
  • Product Name
    Sirpa(NM_001291020) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus signal-regulatory protein alpha (Sirpa), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1542
  • Annotation
    This variant (4) represents the longest transcript and encodes the longest isoform (3). Both variants 4 and 5 encode isoform 3.
  • siRNA

    CCAAGAAUCUCACAAAGAAtt

    GCUGGAGAAUGGAAACGUAtt

    GCGAUCACCCGAAACCAUAtt

  • DataSheet:
  • Product Name
    Sirpa(NM_001177647) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus signal-regulatory protein alpha (Sirpa), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    876
  • Annotation
    This variant (3) lacks two alternate in-frame exons in the central coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 4. The encoded isoform (2) is shorter than isoform 3.
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pEXP-SP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6058
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"