NovoPro
Cart 2
  • Sirpa Rat  cDNA/ORF Clones

Sirpa Rat cDNA/ORF Clones

Cat.#: 708385-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 264.3 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    signal-regulatory protein alpha
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Sirpa
  • Gene Type
    protein coding
  • Also Known as
    Bit; Ptpns1; SHPS-1
  • Encoded Protein Alias
    tyrosine-protein phosphatase non-receptor type substrate 1; Brain immunoglobulin like protein with tyrosine - based activation motifs; CD172 antigen-like family member A; Protein tyrosine phosphatase non-receptor type substrate 1 (SHP substrate 1); Protein tyrosine phosphatase, non-receptor type substrate 1 (SHP substrate 1); SHP substrate 1; brain Ig-like molecule with tyrosine-based activation motifs; inhibitory receptor SHPS-1; macrophage fusion receptor; macrophage membrane protein MFP150; signal-regulatory protein alpha-1; sirp-alpha-1
  • Product Name
    Sirpa(P97710) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus signal-regulatory protein alpha (Sirpa), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1530
  • siRNA
  • DataSheet:
  • Product Name
    Sirpa(NM_013016) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus signal-regulatory protein alpha (Sirpa), mRNA.
  • Synonyms
  • ORF length
    1530
  • siRNA

    GCGAUCACCGAAAACCAUAtt

    CGCUUAAUGGGACCGCUAAtt

    GGAGAAGGGCAAAAUCGGAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"