NovoPro
Cart 2
  • SRP9 Macaca fascicularis  cDNA/ORF Clones

SRP9 Macaca fascicularis cDNA/ORF Clones

Cat.#: 700003-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 5-8 days
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    signal recognition particle 9
  • Organism
    Macaca fascicularis
  • Entrez Gene ID
  • Gene Symbol
    SRP9
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Signal recognition particle 9 kDa protein
  • Product Name
    SRP9(XM_005540997) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca fascicularis signal recognition particle 9kDa (SRP9), mRNA.
  • Synonyms
  • ORF length
    261
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"