NovoPro
Cart 2
  • SHH Chicken  cDNA/ORF Clones

SHH Chicken cDNA/ORF Clones

Cat.#: 736988-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 219.0 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    sonic hedgehog
  • Organism
    Chicken
  • Entrez Gene ID
  • Gene Symbol
    SHH
  • Gene Type
    protein coding
  • Encoded Protein Alias
    sonic hedgehog homolog
  • Product Name
    SHH(NM_204821) Chicken cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Gallus gallus sonic hedgehog (SHH), mRNA.
  • Synonyms
  • ORF length
    1278
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"