Cart 2
  • SELP Sheep  cDNA/ORF Clone

SELP Sheep cDNA/ORF Clone

Cat.#: 734936-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 395.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    selectin P
  • Organism
    Sheep
  • Entrez Gene ID
  • Gene Symbol
    SELP
  • Gene Type
    protein coding
  • Encoded Protein Alias
    CD62 antigen-like family member P; CD62P antigen; GMP-140; LECAM3; PADGEM; granule membrane protein 140; leukocyte-endothelial cell adhesion molecule 3; platelet activation dependent granule-external membrane protein; selectin P (granule membrane protein 140kDa, antigen CD62)
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"