NovoPro
Cart 2
  • Sarnp Rat  cDNA/ORF Clones

Sarnp Rat cDNA/ORF Clones

Cat.#: 701279-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    SAP domain containing ribonucleoprotein
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Sarnp
  • Gene Type
    protein coding
  • Also Known as
    Cip29; RGD1305692
  • Encoded Protein Alias
    SAP domain-containing ribonucleoprotein; cytokine induced protein 29 kDa; nuclear protein Hcc-1
  • Product Name
    Sarnp(XM_008765031) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus SAP domain containing ribonucleoprotein (Sarnp), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    531
  • siRNA

    GAAAAGAAGGUGGUAAAAAtt

    GGAAUAAAACAAGAUCUUAtt

    GGUUAACCUGGAUAAACUAtt

  • DataSheet:
  • Product Name
    Sarnp(XM_006240781) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus SAP domain containing ribonucleoprotein (Sarnp), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    564
  • siRNA

    GAAAAGAAGGUGGUAAAAAtt

    GGAAUAAAACAAGAUCUUAtt

  • DataSheet:
  • Product Name
    Sarnp(NM_001033070) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus SAP domain containing ribonucleoprotein (Sarnp), mRNA.
  • Synonyms
    XM_343147  
  • ORF length
    633
  • siRNA

    GAAAAGAAGGUGGUAAAAAtt

    GGAAUAAAACAAGAUCUUAtt

    GGUUAACCUGGAUAAACUAtt

  • DataSheet:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"