Cart 2
  • Rps6ka1 Rat  cDNA/ORF Clone

Rps6ka1 Rat cDNA/ORF Clone

Cat.#: 742352-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 378.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ribosomal protein S6 kinase A1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Rps6ka1
  • Gene Type
    protein coding
  • Also Known as
    S6K-alpha 1
  • Encoded Protein Alias
    90 kDa ribosomal protein S6 kinase 1; MAP kinase-activated protein kinase 1a; MAPK-activated protein kinase 1a; MAPKAP kinase 1a; MAPKAPK-1a; MAPKAPK1A; RSK-1; S6 protein kinase (Rsk-1); S6K-alpha 1; S6K-alpha-1; p90-RSK 1; p90RSK1; p90S6K; pp90RSK1; ribosomal S6 kinase 1; ribosomal protein S6 kinase polypeptide 1; ribosomal protein S6 kinase, polypeptide A1
  • Product Name
    Rps6ka1(NM_031107) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus ribosomal protein S6 kinase A1 (Rps6ka1), mRNA.
  • Synonyms
  • ORF length
    2208
  • siRNA

    GCUUCGUCCUGUACACCAUtt

    CCUUCUACUUUGAUACCGAtt

    GGAGUACGCAGUCAAAGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"