NovoPro
Cart 2
  • Robo4 Mouse  cDNA/ORF Clones

Robo4 Mouse cDNA/ORF Clones

Cat.#: 704539-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 293.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    roundabout guidance receptor 4
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Robo4
  • Gene Type
    protein coding
  • Also Known as
    AI593217; 1200012D01Rik
  • Encoded Protein Alias
    roundabout homolog 4; Magic roundabout
  • Product Name
    Robo4(XM_006510647) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus roundabout guidance receptor 4 (Robo4), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1710
  • DataSheet:
  • Product Name
    Robo4(XM_011242615) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus roundabout guidance receptor 4 (Robo4), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2616
  • DataSheet:
  • Product Name
    Robo4(XM_006510645) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus roundabout guidance receptor 4 (Robo4), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3204
  • DataSheet:
  • Product Name
    Robo4(XM_006510644) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus roundabout guidance receptor 4 (Robo4), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3225
  • DataSheet:
  • Product Name
    Robo4(NM_028783) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus roundabout guidance receptor 4 (Robo4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3048
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • DataSheet:
  • Product Name
    Robo4(NM_001309390) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus roundabout guidance receptor 4 (Robo4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3069
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"