NovoPro
Cart 2
  • RPS6KA1 Human  cDNA/ORF Clone

RPS6KA1 Human cDNA/ORF Clone

Cat.#: 712065-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 370.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ribosomal protein S6 kinase A1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RPS6KA1
  • Gene Type
    protein coding
  • Also Known as
    RSK; HU-1; RSK1; p90Rsk; MAPKAPK1A
  • Encoded Protein Alias
    ribosomal protein S6 kinase alpha-1; 90 kDa ribosomal protein S6 kinase 1; MAP kinase-activated protein kinase 1a; MAPK-activated protein kinase 1a; MAPKAP kinase 1a; MAPKAPK-1a; RSK-1; S6K-alpha 1; S6K-alpha-1; dJ590P13.1 (ribosomal protein S6 kinase, 90kD, polypeptide 1); p90-RSK 1; p90RSK1; p90S6K; ribosomal S6 kinase 1; ribosomal protein S6 kinase alpha 1
  • Product Name
    RPS6KA1(NM_001330441) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ribosomal protein S6 kinase A1 (RPS6KA1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2160
  • Annotation
    This variant (3) differs in the 5' UTR and 5' end of the coding region compared to variant 1. These differences cause translation initiation at an in-frame AUG of an alternate exon and an isoform (c) with a distinct N-terminus compared to isoform a.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    RPS6KA1(NM_001006665) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ribosomal protein S6 kinase A1 (RPS6KA1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2235
  • Annotation
    This variant (2) differs in the 5' UTR and 5' end of the coding region compared to variant 1. These differences cause translation initiation at an in-frame AUG of an alternate exon and an isoform (b) with a distinct N-terminus compared to isoform a.
  • siRNA

    CACUGAUUCUGAAGGCGAAtt

    ACGGCUACGUGGUAAAGGAtt

    CAUUGACUGGAAUAAGCUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RPS6KA1(NM_002953) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ribosomal protein S6 kinase A1 (RPS6KA1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2208
  • Annotation
    This variant (1) represents the longest transcript and encodes isoform a.
  • siRNA

    CACUGAUUCUGAAGGCGAAtt

    ACGGCUACGUGGUAAAGGAtt

    CAUUGACUGGAAUAAGCUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"