NovoPro
Cart 2
  • RGS3 Human  cDNA/ORF Clone

RGS3 Human cDNA/ORF Clone

Cat.#: 711961-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 863.3 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    regulator of G-protein signaling 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RGS3
  • Gene Type
    protein coding
  • Also Known as
    C2PA; RGP3
  • Encoded Protein Alias
    regulator of G-protein signaling 3; regulator of G-protein signalling 3
  • Product Name
    RGS3(NM_144488) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    3597
  • Annotation
    This variant (6) represents the longest transcript and encodes the longest isoform (6, also known as C2PA-RGS3).
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_011518893) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    2145
  • siRNA

    GAAUACAAAGUGAUUCUUUtt

    AAAUCGAUCGAACAAUUAAtt

    CUCUCAUACUCUUAUCUAAtt

    CUAGGAAAGAUCAGACAUAtt

    ACAUAAAUCAUGCUAAGAAtt

    GAGUCACUUGCAUAGGAAAtt

    ACAAAGAAAUGGACAGUCUtt

    GCACUUUGAUUUCAUUUGAtt

    GGCUCGAGAAGAUGAAACAtt

    CUCGGCAUCUUUAGAGAAAtt

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GCAAGAAACUCCACCCUUUtt

    GAUCAUCUAUGAAAGAAAAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_011518894) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1638
  • siRNA

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_006717220) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    3261
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_017015004) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2886
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_006717219) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3285
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_001276261) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1776
  • Annotation
    This variant (8) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR and 5' coding region, and it lacks an alternate in-frame exon in the 3' coding region, compared to variant 6. The encoded isoform (7) is shorter and has a distinct N-terminus, compared to isoform 6.
  • siRNA

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_134427) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    507
  • Annotation
    This variant (9) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR, lacks a large portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 6. The encoded isoform (4, also known as RGS3S in PubMedID:11330340) is significantly shorter at the N-terminus, compared to isoform 6. Both variants 4 and 9 encode isoform 4.
  • siRNA

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_001282923) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 10, mRNA.
  • Synonyms
  • ORF length
    3267
  • Annotation
    This variant (10) uses an alternate 5' structure and thus differs in the 5' UTR and 5' coding region compared to variant 6. These differences cause translation initiation at an alternate AUG and result in an isoform (8) with a shorter and distinct N-terminus, compared to isoform 6.
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_144489) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    936
  • Annotation
    This variant (5) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR, lacks a large portion of the 5' coding region, and uses an alternate start codon, compared to variant 6. The encoded isoform (5, also known as RGS3S in PubMed ID:12036301) has a significantly shorter and distinct N-terminus, compared to isoform 6.
  • siRNA

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_017015003) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3474
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_006717225) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1566
  • siRNA

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_001276260) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1560
  • Annotation
    This variant (7) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR, lacks a large portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 6. The encoded isoform (2) is significantly shorter at the N-terminus, compared to isoform 6. Both variants 2 and 7 encode the same isoform (2).
  • siRNA

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_017790) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1809
  • Annotation
    This variant (3) lacks several 5' and 3' exons but includes alternate 5' and 3' exons, and it thus differs in both UTRs and in the 5' and 3' coding regions, compared to variant 6. The encoded isoform (3) is shorter and has distinct N- and C-termini, compared to isoform 6.
  • siRNA

    GGCUUUCCACGAGCACUUCtt

    GCAGAGUGCUUAUUCACUUtt

    GCAAGAAACUCCACCCUUUtt

    GAUCAUCUAUGAAAGAAAAtt

    CCCUGAAGAUAGUAGACUAtt

    CCCUGAAGAUAGUAGACUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(XM_006717222) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2475
  • siRNA

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RGS3(NM_130795) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2754
  • Annotation
    This variant (1) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 6. The encoded isoform (1, also known as PDZ-RGS3) has a shorter and distinct N-terminus, compared to isoform 6.
  • siRNA

    GCAGAGUGCUUAUUCACUUtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

    GACCUCUACCUGGACCUUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"