NovoPro
Cart 2
  • Tsta3 Rat  cDNA/ORF Clone

Tsta3 Rat cDNA/ORF Clone

Cat.#: 767925-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 143.5 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    tissue specific transplantation antigen P35B
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Tsta3
  • Gene Type
    protein coding
  • Product Name
    Tsta3(NM_001270790) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus tissue specific transplantation antigen P35B (Tsta3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    837
  • Annotation
    This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
  • siRNA

    GCAAUUUUGGGUACUCAUAtt

    CCAUCUUGCUGCAAUGGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Tsta3(NM_001270789) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus tissue specific transplantation antigen P35B (Tsta3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    966
  • Annotation
    This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a).
  • siRNA

    GCAAUUUUGGGUACUCAUAtt

    GGAAGAACGUGCACAUCAAtt

    CCAUCUUGCUGCAAUGGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"