NovoPro
Cart 2
  • Prss36 Rat  cDNA/ORF Clones

Prss36 Rat cDNA/ORF Clones

Cat.#: 751011-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 443.8 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protease, serine, 36
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Prss36
  • Gene Type
    protein coding
  • Product Name
    Prss36(XM_017589542) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus protease, serine, 36 (Prss36), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2589
  • siRNA
  • DataSheet:
  • Product Name
    Prss36(XM_017589543) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus protease, serine, 36 (Prss36), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2550
  • siRNA
  • DataSheet:
  • Product Name
    Prss36(XM_008759913) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus protease, serine, 36 (Prss36), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2583
  • siRNA

    GCAUGUGACUGGUGAUAGAtt

  • DataSheet:
  • Product Name
    Prss36(NM_001011560) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus protease, serine, 36 (Prss36), mRNA.
  • Synonyms
    XM_215087  
  • ORF length
    2550
  • siRNA

    GCAUGUGACUGGUGAUAGAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"