NovoPro
Cart 2
  • Gls2 Rat  cDNA/ORF Clones

Gls2 Rat cDNA/ORF Clones

Cat.#: 767811-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 272.0 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    glutaminase 2
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Gls2
  • Gene Type
    protein coding
  • Also Known as
    Ga
  • Product Name
    Gls2(XM_017594652) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus glutaminase 2 (Gls2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1587
  • siRNA
  • DataSheet:
  • Product Name
    Gls2(NM_001270786) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus glutaminase 2 (Gls2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1809
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GAUGGACUGUAACAAAGCAtt

    GGUCAAUGCUGGUGCUAUUtt

    CAAGAUGGACUGUAACAAAtt

    GCACUGUGCUCGGAAGUUAtt

  • DataSheet:
  • Product Name
    Gls2(NM_138904) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus glutaminase 2 (Gls2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1608
  • Annotation
    This variant (3) lacks the first exon and extends 5' into intronic sequence compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.
  • siRNA

    GAUGGACUGUAACAAAGCAtt

    GGUCAAUGCUGGUGCUAUUtt

    CAAGAUGGACUGUAACAAAtt

    GCACUGUGCUCGGAAGUUAtt

  • DataSheet:
  • Product Name
    Gls2(NM_001270787) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus glutaminase 2 (Gls2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1740
  • Annotation
    This variant (2) uses an alternate splice site at the 3' end of the first exon compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.
  • siRNA

    GAUGGACUGUAACAAAGCAtt

    GGUCAAUGCUGGUGCUAUUtt

    CAAGAUGGACUGUAACAAAtt

    GCACUGUGCUCGGAAGUUAtt

  • DataSheet:
  • Product Name
    Gls2(XM_017594653) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus glutaminase 2 (Gls2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1476
  • siRNA
  • DataSheet:
  • Product Name
    Gls2(XM_006240728) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus glutaminase 2 (Gls2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1716
  • siRNA

    GAUGGACUGUAACAAAGCAtt

    GGUCAAUGCUGGUGCUAUUtt

    CAAGAUGGACUGUAACAAAtt

  • DataSheet:
  • Product Name
    Gls2(XM_017594654) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus glutaminase 2 (Gls2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1242
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"