NovoPro
Cart 2
  • Csf1r Rat  cDNA/ORF Clones

Csf1r Rat cDNA/ORF Clones

Cat.#: 760622-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 503.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    colony stimulating factor 1 receptor
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Csf1r
  • Gene Type
    protein coding
  • Also Known as
    c-fms; mrfms; CSF-1R; CSF-1-R; M-CSF-R
  • Product Name
    Csf1r(XM_008772147) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus colony stimulating factor 1 receptor (Csf1r), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2937
  • siRNA

    CCGGAGAACAUAUACAGCAtt

    CGAAUACUGCUGCUACGGAtt

    CCGUUGUACUGAGCUUGAAtt

  • DataSheet:
  • Product Name
    Csf1r(NM_001029901) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus colony stimulating factor 1 receptor (Csf1r), mRNA.
  • Synonyms
    XM_225897  
  • ORF length
    3069
  • siRNA

    CCGGAGAACAUAUACAGCAtt

    CGAAUACUGCUGCUACGGAtt

    CCGUUGUACUGAGCUUGAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"