NovoPro
Cart 2
  • Cmc1 Rat  cDNA/ORF Clone

Cmc1 Rat cDNA/ORF Clone

Cat.#: 767775-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    C-x(9)-C motif containing 1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cmc1
  • Gene Type
    protein coding
  • Also Known as
    RGD1305283
  • Product Name
    Cmc1(NM_001199225) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus C-x(9)-C motif containing 1 (Cmc1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    321
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GUCUAACUGCUUACUAUAAtt

    GGAUCCUUAUGGUAUUAAAtt

    GAACUGGAGUUCCUACCAAtt

    GAACAAGUUGAAGAUUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cmc1(NM_001135259) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus C-x(9)-C motif containing 1 (Cmc1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    201
  • Annotation
    This variant (2) differs in the 3' CDS and 3' UTR compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.
  • siRNA

    GGAUCCUUAUGGUAUUAAAtt

    GAACAAGUUGAAGAUUUUAtt

    GUAUGUUACAGGUUAUUCUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cmc1(XM_006244034) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus C-x(9)-C motif containing 1 (Cmc1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    390
  • siRNA

    GUCUAACUGCUUACUAUAAtt

    GGAUCCUUAUGGUAUUAAAtt

    GAACUGGAGUUCCUACCAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"