NovoPro
Cart 2
  • Cacna1b Rat  cDNA/ORF Clone

Cacna1b Rat cDNA/ORF Clone

Cat.#: 767774-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium voltage-gated channel subunit alpha1 B
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cacna1b
  • Gene Type
    protein coding
  • Also Known as
    BIII
  • Product Name
    Cacna1b(XM_008761578) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    7080
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(NM_001195199) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    7065
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233575) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    7017
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233577) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    7011
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233569) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    7080
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233578) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    7008
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233570) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    7077
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233572) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    7074
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(NM_147141) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant 2, mRNA.
  • Synonyms
    XM_346648  
  • ORF length
    7002
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233573) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    7068
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233574) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    7062
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna1b(XM_006233576) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus calcium voltage-gated channel subunit alpha1 B (Cacna1b), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    7014
  • siRNA

    CAGUCGUUCCAGUAUAAGAtt

    CGGAGAUUGCGGAAACGAAtt

    GGGUUUUCCUUCGACAAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"