Cart 2
  • Ank3 Rat  cDNA/ORF Clone

Ank3 Rat cDNA/ORF Clone

Cat.#: 754504-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ankyrin 3
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Ank3
  • Gene Type
    protein coding
  • Also Known as
    ANK-3
  • Product Name
    Ank3(NM_031805) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus ankyrin 3 (Ank3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    5955
  • Annotation
    This variant (1) has a different 5' UTR and multiple differences in the coding region but maintains the reading frame, compared to variant 2. This variant encodes isoform 1 which is shorter than isoform 2. Isoform 1 is also known as AnkG217.
  • siRNA

    CCUGAAUCCCAAAACGAUAtt

    GCACGGUGCAUCUAUUCAAtt

    GCCUUAACUUCGGUCUUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_001033984) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus ankyrin 3 (Ank3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    7869
  • Annotation
    This variant (2) represents the longest variant and it encodes the longest protein (isoform 2). Isoform 2 is also known as '270 kDa ankyrin-G'.
  • siRNA

    CCUGAAUCCCAAAACGAUAtt

    GCACGGUGCAUCUAUUCAAtt

    GCCUUAACUUCGGUCUUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"