NovoPro
Cart 2
  • Ak4 Rat  cDNA/ORF Clones

Ak4 Rat cDNA/ORF Clones

Cat.#: 761632-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    adenylate kinase 4
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Ak4
  • Gene Type
    protein coding
  • Also Known as
    AK 4; Ak3l1; Ak3l2
  • Product Name
    Ak4(NM_017135) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus adenylate kinase 4 (Ak4), mRNA.
  • Synonyms
  • ORF length
    672
  • siRNA

    GGCCUUAUGUUUACACGCUtt

    GGCUAAGACGGUACAAGGAtt

    GCAAAACAGUACCUAGAAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"