Cart 2
  • A2m Rat  cDNA/ORF Clone

A2m Rat cDNA/ORF Clone

Cat.#: 757754-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 1,060.6 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    alpha-2-macroglobulin
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    A2m
  • Gene Type
    protein coding
  • Also Known as
    Mam; A2m1; A2mb; A2maa; A2MAC1
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"